• Users Online: 346
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
REVIEW ARTICLE
Year : 2022  |  Volume : 8  |  Issue : 2  |  Page : 57-61

Asian crocodile poaching: A review of molecular techniques developed for forensic identification


1 Division of Biology, Central Forensic Science Laboratory, Kolkata, West Bengal, India
2 Office of Director, Central Forensic Science Laboratory, Chandigarh, India

Date of Submission22-Jul-2021
Date of Decision04-Mar-2022
Date of Acceptance04-Mar-2022
Date of Web Publication28-Jun-2022

Correspondence Address:
Ishani Mitra
Division of Biology, Central Forensic Science Laboratory, 30, Gorachand Road, Kolkata - 700 014, West Bengal
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jfsm.jfsm_49_21

Rights and Permissions
  Abstract 


Crocodiles, gharials and alligators (order Crocodilia), are aquatic reptiles that live in the tropics of Asia, America, Africa, and Australia. Asian countries such as India, Indonesia, Malaysia, and tropics of Australia are the stronghold of the family Crocodylidae. Among all 23 crocodile species, nine species occur in Asia and its surroundings, including the only member of Gavialidae and Alligatoridae family. They are “mugger” or “Crocodylus palustris,” “saltwater crocodile” or “Crocodylus porosus,” “Philippine crocodile” or “Crocodylus mindorensis,” “New Guinea crocodile” or “Crocodylus novaeguineae,” “Siamese crocodile” or “Crocodylus siamensis,” “gharials” or “Gavialis gangeticus,” “false gharial” or “Tomistoma schlegelii,” and “Chinese alligator” or “Alligator sinensis.” All of these species have been encompassed in “Appendix I” and “Appendix II” of the “Convention on International Trade in Endangered Species of Wild Fauna and Flora,” which prevents any kind of trade involving crocodilian species. However, it has been observed that these crocodiles are illegally poached and trafficked for their lucrative skin, meats, eggs, snouts, and bones in medicinal and cosmetic industries. Although many molecular biologists have come forward for the conservation of these species, lack of knowledge about the available, fast, and dependable techniques makes it difficult for forensic identification of seized or confiscated. It has been a major problem for the implementation of the “Wildlife Protection Law” on illegal trade. This article focuses on molecular techniques developed till date for the rapid and reliable species identification and conservation study of them.

Keywords: Convention on International Trade in Endangered Species of Wild Fauna and Flora, Crocodilia, illegal poaching and trading, molecular techniques, species identification


How to cite this article:
Mitra I, Roy S, Haque I. Asian crocodile poaching: A review of molecular techniques developed for forensic identification. J Forensic Sci Med 2022;8:57-61

How to cite this URL:
Mitra I, Roy S, Haque I. Asian crocodile poaching: A review of molecular techniques developed for forensic identification. J Forensic Sci Med [serial online] 2022 [cited 2022 Sep 30];8:57-61. Available from: https://www.jfsmonline.com/text.asp?2022/8/2/57/348656




  Introduction Top


Asian countries are a unique subcontinent with great diversity of natural ecosystems. Every ecosystem has its own unique representation of species. Today, many wild species are disappearing rapidly due to global warming, population explosion, urbanization, and illegal trafficking. Each aquatic reptile plays an important role in maintaining the river and estuarine ecosystem. Among all reptiles, a small order Crocodilia is represented by 23 species, of which three species, “mugger” or “Crocodylus palustris,” “saltwater or estuarine crocodile” or “Crocodylus porosus,” and “gharial” or “Gavialis gangeticus” are found in India and its subcontinents.[1] The “Philippine crocodile” or “Crocodylus mindorensis” is limited to a few islands in the Philippines. The “New Guinea crocodile” or “Crocodylus novaeguineae” is restricted to Irian Jaya (Indonesia) and Papua New Guinea. The “Siamese crocodile” or “Crocodylus siamensis” is found in and around Thailand, Indonesia, and Malaysia. The “false gharial” or “Tomistoma schlegelii” is found in the further east of the Indian gharial's range, in Indonesia, Malaysia, and Thailand. Finally, the “Chinese alligator” or ”Alligator sinensis” is the only member of the family Alligatoridae, which are the major predators in their habitats around eastern China and can be threatening to humans and their livestock. These crocodilian species are of high economic and medicinal values. They usually get exploited because of their lucrative body parts such as skin, meats, eggs, snouts, and bones in the international market. Due to such exploitation and unnatural habitat loss, currently, they have got enlisted in “Appendices I and II” of the “Convention on International Trade in Endangered Species of Wild Fauna and Flora” (CITES). The beneficial medicinal products from these species and the bush meat crisis also remain to be the perennial major causes for their depletion in the environment.[2] In particular, the hide of “C. porosus” is extremely valuable, as it is devoid of ventral osteoderms (make tanning of the skin difficult) and the unusual size and shape of the belly scales. The eggs of “G. gangeticus” are believed to have medicinal properties, and the snouts of adult males have aphrodisiac effects.[3] Therefore, “International Union for the conservation of Nature and Natural resources Red list” of the threatened species regarded “estuarine” or saltwater crocodile, “New Guinea crocodile,” and “Australian freshwater crocodile” as a species under lower risk; “mugger” as vulnerable species; “false gharial” as endangered; and “Siamese crocodile,” “Philippine crocodile,” “Chinese alligator,” and “gharial” as critically endangered. However, the existence of these natural antiquities has worsened due to continuous illegal poaching and trading. Now, for the protection and conservation of these crocodiles, gharials and alligators, the Asian countries have inculcated “Wildlife Protection Act (WPA),” which includes all of these species in “Schedule I.”[4]

Most of the times, the seized wildlife parts and products are in such condition that it becomes really impossible to identify the exact species through morphological and serological examination at any laboratory.[5] They get processed as leather jackets, bags, belts, wallets, shoes, and other accessories from the crocodile skin or turned into medicines for skin disease and pain management.[6],[7] Such confiscated materials are needed to be authenticated with the best possible rapid and economic techniques. To overcome such challenges, crocodile researchers have developed different techniques at molecular level for proper species identification. Unfortunately, lack of awareness of the available forensic identification techniques for confiscated crocodile materials proves to be a major obstacle in implementing effective law enforcement. Hence, in this standpoint, the use of proper molecular techniques for species identification is mandatory.

To overcome these situations, there are two possible ways to handle the crisis. One is habitat conservation and the second is captive breeding. The conservation geneticists are working on them. However, to implicate strict WPA as a forensic biologist, our work is to establish easy, fast, and valid identification techniques at molecular level to stop the illegal killing and trafficking of these species.


  Molecular Techniques Developed for the Identification of Asian Crocodiles Top


Mitochondrial DNA markers are the preferred one for the identification of a species, no matter how much fabrication has been applied to the trafficked and hunted animal exhibits. This has been the success of forensic scientists to identify the species using molecular biology. Starting from polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) to DNA barcoding and microsatellite development, many studies have been adopted by the crocodile researchers to identify the exact species of these Indian reptiles. [Table 1] lists name of different technologies developed and used for Forensic identification of crocodile specimen.
Table 1: Forensic identification of crocodile specimen using different methodology

Click here to view


When authentication of trafficked or poached animals is questioned, some PCR-based assays have been used for crocodile identification. One of them is PCR-RFLP, some are conventional PCR methods, one is double gene targeting multiplex PCR, and others are multiplex PCR assays. DNA barcoding has also been developed for their species identification and phylogenetic study.

Polymerase chain reaction-based restriction fragment length polymorphism

The PCR-RFLP techniques have been developed as a cost-effective identification tool for all the three Indian crocodilian species targeting the cytochrome b (cyt b) gene. Following primers were designed “CP14126: 5'-ACC AAG ACT TGA GGC ACG AAA AAC C-3';” “CP14860: 5'-AGG ATA AAT GGG AGC AGG AAG TG-3'” for PCR amplification of the samples followed by RFLP analysis using HaeIII, MboI, and MwoI restriction enzyme digestion, helping in rapid evaluation of species status of the sample in question.[5]

Conventional polymerase chain reaction analysis

Two sets of PCR primers targeting cyt b and 16S rRNA gene have been developed for the identification of six crocodilian species, namely, C. porosus, C. palustris, C. siamensis, Crocodylus niloticus, Caiman crocodilus, and G. gangeticus. The designed primers are as follows: For cyt b Primer Set 1: “CP14126: 5'ACC AAG ACT TGA GGC ACG AAA AAC C 3'” and “CP14860: 5' AGG ATA AAT GGG AGC AGG AAG TG3'” and Primer Set 2: “CP14715: 5' TGA GGA GCA ACC GTA ATT ACC AAC CT 3'” and “CP15546: 5' TCT GTC TTACAA GGC CAG TGC TTT 3',” which amplified 628 bp and 800 bp of sequences, and for 16S rRNA Primer Set I: “16SFI: 5'-AAA GCA TTC TGC CTA CAC CTG AAA-3'” and “16SRI: 5'-TTG TGT TGG CTG CTT TAA GGC CTA-3'” and Primer Set II: “16SFII: 5'-TGC TTG GGA ACA GAA TAT AAG TTC-3'” and “16SRII: 5'-CTG CTT TTG CAC AGG GAG ATC AAT TTC-3',” which amplified 600 bp and 690 bp of sequences.[8],[9] These sequences have been later combined to obtain 1290 bp sequence of 16S rRNA gene in six crocodile species, i.e., G. gangeticus, C. porosus, C. palustris, C. siamensis, C. niloticus and C. crocodilus. The sequence alignment result shows a certain number of polymorphic sites in each species; intraspecific polymorphisms are an important deliberation for species identification.[10]

Multiplex polymerase chain reaction

A multiplex PCR primer pair set has been developed after the successful implication of conventional PCR analysis method. The following primer pairs were designed for the analysis of Chinese alligator meat and commercial products, which being sold illegally in the market: “Alli-M: 5'-GCACTTCTCATCGGGTGAC-3'” and “Alli-R: 5'-ACGTGCTCTCGTGAAGGTAG-3'” .[11] On the other hand, another study developed a simple multiplex PCR assay based on cyt b gene, where the species-specific forward primers: “MUG 5' TACGTGGGAAACTCAATCGTGG 3'” (373 bp) for C. palustris, “SAL 5' AGCTTCCCTATTCTTCCTATGCACA 3'” (578 bp) for C. porosus, “GHA 5' TCATCCTGCTCCTCTTATTAATAGCG 3'” (486 bp) for G. gangeticus, and a universal reverse primer, “UNI 5' GTGTAGGCGAATAGGAAGTATCATTC 3'” have been designed to yield specific-sized PCR products for each species.[12] This novel multiplex PCR aids in quick and unambiguous identification of Indian crocodile species.

DNA barcoding

Taxonomic classification and identification of reptiles is a challenging task. The potential of partial cytochrome-c oxidase subunit 1 (COI) gene sequences is an efficient tool for species identification and has shown that the COI gene of crocodilians has adequate nucleotide diversity and modest rates of nucleotide evolution, permitting the discrimination of closely related species.[13] Since then, molecular concept of DNA barcoding has become a trend for identification and subsequent phylogenetic studies for different types of organisms. About 648 bp region from the 5' end of the COI gene has been suggested as the barcode for animals. To coordinate DNA barcoding globally, the “Consortium for the Barcode of Life” and “Barcode of Life Data System” have been launched.[14] The following primer set, “CP5376: 5' TCCACTAACCACAAAGATATCGGCACC 3'” and “CP6079: 5' TAGAAGGTGATTACATGGGAGATTATTCC 3'” showed the efficiency of this technique for species identification.[15] For forensic purposes, skin samples were used for molecular identification of crocodiles.[16]

Double gene targeting multiplex polymerase chain reaction assay

Recently, identification of crocodile species C. porosus is achieved by targeting small region of atp 6 (77 bp) and cyt b (127 bp) genes to make the experiment more stable and sensitive for identification of forensic specimen. The primers designed have been for “atp 6 (forward): 5' GCATACCACTACTAATCCCAG 3'” and “atp 6 (reverse): 5' GTTTGATAGTCAGCGATCTTG 3'” and for “cyt b (forward): 5' CTCATAGCCACCATCCTCAC 3'” and “cyt b (reverse): 5' TCTCAGCAAAAGACGCCATAG 3'.”[17] Using these primer sets, they have been able to identify C. porosus from traditional medicine and have meatball food products through multiplexing.

Microsatellite markers

Earlier, 20 microsatellite markers have been developed to study the population of C. siamensis in which 10 have been polymorphic and 10 monomorphic.[18] Later, isolation and characterization of 18 microsatellite loci from G. gangeticus have been performed to study their genetic variation and population genetics. All the 18 loci showed polymorphism among 32 individuals of G. gangeticus.[19] Besides that, 11 microsatellite markers have been developed to study the population of C. mindorensis and compared them to four other crocodilian species sample sets.[20]

Complete mitochondrial genome

According to the National Centre for Biotechnology Information database on complete mitochondrial genome sequences, there are data of 22 different crocodile species at present. They have been studied to construct crocodile phylogeny and to study their conservation status. The complete mitochondrial genome sequences of all the three Indian crocodilian species have been done to study their phylogenetic relationship with other crocodilian species and their evolutionary data. The mitochondrial genomes of Crocodylus moreletii, Crocodylus johnstoni, and C. palustris are 16,827 bp, 16,851 bp, and 16,852 bp in length, respectively.[21] These mitochondrial genomes consist of conventional “13 protein coding genes,” “2 ribosomal RNA genes,” “22 transfer RNA genes,” and a “non-coding region.”

The mitochondrial genomes of all the Crocodylus species studied herein show identical characteristics in terms of nucleotide composition and codon usage, suggestive of the existence of analogous evolutionary patterns within the genus, Crocodylus. The phylogenetic analyses based on data from COI gene sequences of mitochondrial DNA confirm the previously established crocodilian phylogeny [Figure 1].[22]
Figure 1: Maximum likelihood tree constructed using cytochrome-c oxidase subunit 1 gene of crocodiles using in MEGA 7. It shows crocodiles as near species of tortoise[22]

Click here to view


Next-generation sequencing method and its applications

Ever since the adaptation of next-generation sequencing (NGS) technology in conservation genetics evolved, a new horizon for study about wild lives is coming out.[23] The course of parallel sequencing gives the chance to identify new STRs or SNP from a pool of repetitive DNA sequences. These newly identified loci can be used to characterize the number of alleles, heterozygosity, linkage equilibrium, polymorphic content, and deviations from Hardy–Weinberg equilibrium, which in turn will help in the study of population of an organism. Adding to this, forensic identification of different body fluids and their sources as well as identification of organ tissue, segregation from mixed profile, and calculation of postmortem interval can also be possible through study of transcriptome by utilizing this technique as RNAseq.[24],[25],[26] Recently, by using NGS, it has been successfully possible to differentiate the content of traditional medicine, which is often a mixture of different wild specimens. By means of using different types of high-throughput sequencing techniques, many related analysis has been be performed, such as de novo assembling, reference-based genome assembly, captive breeding of reintroduced specimens genetic screening, and RNAseq for the identification and characterization of saltwater crocodiles, Chinese crocodile, Nile crocodile, and many more.[27],[28],[29] Somehow, this needed to get validated for regular implementation in forensic usage through further research work on forensic identification of crocodiles and their morphed body parts or different organ by using available high-throughput sequencing platform through different technologies such as RNAseq, characterization of microsatellites markers, and whole-genome sequencing database to name a few.

There are various NGS instruments available at present that function by the use of different sequencing techniques. They are applicable from smaller to larger scale functions. For example, Illumina (CA, USA) manufactures the HiSeq 2000 for larger scale applications and the MiSeq for smaller scale applications.[30]

Statistics of wildlife crime related with crocodile trading

The recent data on crocodile trading from the CITES database show a constant decrease in their exported and imported quantity for the year 2015–2019.[31] It is a result of their constant depletion from the wild as being a part of global urbanization, poaching and illegal trafficking, as well as an indication to show that there still exists a strong illegal trading business of wildlife creatures despite having CITES regulations all over the world. [Figure 2] shows the quantity of both exported and imported samples of Crocodylus. The overall trade of crocodile species imported in 2020 is more than 3000 samples.
Figure 2: A bar chart statistics of globally traded crocodiles for the year 2015–2020 made from Convention on International Trade in Endangered Species of Wild Fauna and Flora database[32]

Click here to view



  Discussion Top


Despite being protected by the WPA, 1972, Indian crocodilian species are at a risk of extinction. It is believed that their body parts have got some medicinal value. They are getting over exploited by wildlife goons for their hard skin and meat. At times, they get highly processed making their identification questionable. Although many works have been performed till date for the identification of crocodile species, it requires more advance and fast technologies to identify morphologically altered and processed samples. The lack of advance, fast, reliable, valid, and conclusive identification techniques from confiscated crocodile samples makes it very difficult to enforce the proper law. Hence, there is a serious requirement for a fast, advanced, robust, and economic forensic identification technique which will help in the identification of all the living crocodile species. This article focuses on the molecular techniques developed till date for the rapid and reliable species identification and conservation study of them. Also we suggest, study of the whole-genome sequencing from all living crocodile species and build a strong DNA database for them so that better conservation strategies, breeding strategies and individual identification of a crocodile species from the wild can be fulfilled. The techniques and primer details described here can help the law enforcement agencies in the Forensic identification of Asian crocodile species. That can be an easy and reliable method for identification and differentiation of all the Asian crocodile species along with other crocodilian species for forensic authentication. It is on the wildlife forensic scientists, police personnel, and law enforcement agencies to use any of the available techniques for crocodilian species identification so that actual wildlife criminals get convicted easily.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
King FW, Burke RL, editors. Crocodilian, Tuaturan and Turtle Species of the World: A Taxonomic and Geographic Reference. Washington, DC: Association of Systematics Collections; 1989.  Back to cited text no. 1
    
2.
Klemens MW, Thorbjarnarson JB. Reptiles as a food resource. Biodivers Conserv 1995;4:281-98.  Back to cited text no. 2
    
3.
Gad SD. Indian Gharial (Gavialis gangeticus) on the verge of extinction. Curr Sci 2008;94:1549.  Back to cited text no. 3
    
4.
Available from: http://www.iucnredlist.org. [Last accessed on 2019 Nov 26].  Back to cited text no. 4
    
5.
Meganathan PR, Dubey B, Haque I. Molecular identification of Indian crocodile species: PCR-RFLP method for forensic authentication. J Forensic Sci 2009;54:1042-5.  Back to cited text no. 5
    
6.
7.
Davis B. Crocodiles in Vietnam Skinned Alive in Service of Fashion, Forbes; December 22, 2016.  Back to cited text no. 7
    
8.
Meganathan PR, Dubey B, Haque I. Molecular identification of crocodile species using novel primers for forensic analysis. Conserv Genet 2009;10:767-70.  Back to cited text no. 8
    
9.
Jogayya KN, Meganathan PR, Dubey B, Haque I. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species. J Forensic Legal Med 2013;20:334-8.  Back to cited text no. 9
    
10.
Waits LP, Paetkau D. Noninvasive genetic sampling tools for wildlife biologists: A review of applications and recommendations for accurate data collection. J Wildl Manage 2005;69:1419-33.  Back to cited text no. 10
    
11.
Yan P, Wu XB, Shi Y, Gu CM, Wang RP, Wang CL. Identification of Chinese alligators (Alligator sinensis) meat by diagnostic PCR of the mitochondrial cytochrome b gene. Biol Conser 2005;121:45-51.  Back to cited text no. 11
    
12.
Meganathan PR, Dubey B, Jogayya KN, Whitaker N, Haque I. A novel multiplex PCR assay for the identification of Indian crocodiles. Mol Ecol Resour 2010;10:744-7.  Back to cited text no. 12
    
13.
Hebert PD, Cywinska A, Ball SL, deWaard JR. Biological identifications through DNA barcodes. Proc Biol Sci 2003;270:313-21.  Back to cited text no. 13
    
14.
Ratnasingham, Sujeevan & Hebert, Paul. (2007). BOLD: The Barcode of Life Data System (www.barcodinglife.org). Molecular ecology notes. 7. 355-364. 10.1111/j.1471-8286.2007.01678.x.  Back to cited text no. 14
    
15.
Meganathan PR, Dubey B, Jogayya KN, Haque I. Identification of Indian crocodile species through DNA barcodes. J Forensic Sci 2013;58:993-8.  Back to cited text no. 15
    
16.
Eaton MJ, Meyers GL, Kolokotronis SO, Leslie MS, Martin AP, Amato G. Barcoding bushmeat: Molecular identification of Central African and South American harvested vertebrates. Conserv Genet 2010;11:1389-404.  Back to cited text no. 16
    
17.
Ahmad Nizar NN, Sultana S, Motalib Hossain MA, Johan MR, Ali E. Double gene targeting multiplex PCR-RFLP detects Crocodylus porosus in chicken meatball and traditional medicine. Int J Food Properties 2018;21:2037-51.  Back to cited text no. 17
    
18.
Chaeychomsri S, Tabthipwon P, Noparatnaraporn N, Siripholvat V. Development of microsatellite markers for Siamese crocodile (Crocodylus siamensis). Agricultural Science Journal Science field. Year 42, No. 2, (Apr.-Jun. 2008), pages 256-262.  Back to cited text no. 18
    
19.
Jogayya KN, Meganathan PR, Dubey B, Haque I. Novel microsatellite DNA markers for Indian Gharial (Gavialis gangeticus). Conserv Genet Resour 2013;5:787-90.  Back to cited text no. 19
    
20.
Hinlo MR, Tabora JA, Bailey CA, Trewick S, Rebong G, van Weerd M, et al. Population genetics implications for the conservation of the Philippine Crocodile Crocodylus mindorensis Schmidt, 1935 (Crocodylia: Crocodylidae). J Threatened Taxa 2014;6:5513-33.  Back to cited text no. 20
    
21.
Meganathan PR, Dubey B, Batzer MA, Ray DA, Haque I. Complete mitochondrial genome sequences of three Crocodylus species and their comparison within the Order Crocodylia. Gene 2011;478:35-41.  Back to cited text no. 21
    
22.
Kumar S, Stecher G, Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 33:1870. (Accessed on 2021 Nov 24).  Back to cited text no. 22
    
23.
Mukudai Y, Yang F, Ding F, Chen H, He M, Zhu S, et al. DNA barcoding for the identification and authentication of animal species in traditional medicine. Evid Based Complement Altern Med 2018;2018:5160254.  Back to cited text no. 23
    
24.
Lin MH, Jones DF, Fleming R. Transcriptomic analysis of degraded forensic body fluids. Forensic Sci Int Genet 2015;17:35-42.  Back to cited text no. 24
    
25.
Sauer E, Extra A, Cachée P, Courts C. Identification of organ tissue types and skin from forensic samples by microRNA expression analysis. Forensic Sci Int Genet 2017;28:99-110.  Back to cited text no. 25
    
26.
Haas C, Neubauer J, Salzmann AP, Hanson E, Ballantyne J. Forensic transcriptome analysis using massively parallel sequencing. Forensic Sci Int Genet 2021;52:102486.  Back to cited text no. 26
    
27.
Ghosh A, Johnson MG, Osmanski AB, Louha S, Bayona-Vásquez NJ, Glenn TC, et al. A high-quality reference genome assembly of the saltwater crocodile, Crocodylus porosus, reveals patterns of selection in Crocodylidae. Genome Biol Evol 2020;12:3635-46.  Back to cited text no. 27
    
28.
Gao J, Li Q, Wang Z, Zhou Y, Martelli P, Li F, et al. Sequencing, de novo assembling, and annotating the genome of the endangered Chinese crocodile lizard Shinisaurus crocodilurus. Gigascience 2017;6:gix041.  Back to cited text no. 28
    
29.
Azeez OI, Myburgh JG, Bosman AM, Featherston J, Sibeko-Matjilla KP, Oosthuizen MC, et al. Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism (s) of pathogenesis and pathophysiology of pansteatitis. PLoS One 2019;14:e0225073.  Back to cited text no. 29
    
30.
Shokralla S, Spall JL, Gibson JF, Hajibabaei M. Next-generation sequencing technologies for environmental DNA research. Mol Ecol 2012;21:1794-805.  Back to cited text no. 30
    
31.
Available from: https://trade.cites.org/. [Last accessed on 2021 Nov 22].  Back to cited text no. 31
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Molecular Techni...
Discussion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed763    
    Printed34    
    Emailed0    
    PDF Downloaded118    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]