|
|
ORIGINAL ARTICLE |
|
Year : 2020 | Volume
: 6
| Issue : 1 | Page : 1-4 |
|
A potential marker DYF371 for differentiating han population from non-han population in Chinese
Hailun Nan, Dejian Lu
Faculty of Forensic Medicine, Zhongshan Medical School, Sun Yat-Sen University, Guangzhou, China
Date of Submission | 01-Jan-2020 |
Date of Decision | 24-Feb-2020 |
Date of Acceptance | 24-Feb-2020 |
Date of Web Publication | 17-Mar-2020 |
Correspondence Address: Dejian Lu Faculty of Forensic Medicine, Zhongshan Medical School, Sun Yat-Sen University, 74# Zhongshan Road Ii, Guangzhou, 510089 China
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/1735-3327.280892
DYF371 locus and single-nucleotide polymorphisms (SNPs) defined as DYF371C or DYF371T were simultaneously examined for 142 Chinese unrelated male individuals, including 90 Han population and 52 minorities. In total, 37 SNP-short tandem repeat haplotypes were detected. Nine of these 37 haplotypes were unique (24.32%). The gene diversity and discrimination capacity values are 0.8321 and 0.2606, respectively. Furthermore, only five males (5.55%) in the Han samples were determined that they had one copy of allele with SNP T-type and three copies of alleles with SNP C-types, whereas 14 individuals (26.92%) were observed in minorities' samples. The genotype proportion comprising three distinguishing copies of the allele with SNP C-types in Han sample was greatly lower than that in the sample of minorities. Similar results were shown for allele 11C and 10C. Therefore, the alleles of DYF371 with SNP C-type have the potential to differentiate the Han and non-Han Chinese populations.
Keywords: DYF371, multi-copy, multiplex polymerase chain reaction, single-nucleotide polymorphism, polymorphism-short tandem repeat
How to cite this article: Nan H, Lu D. A potential marker DYF371 for differentiating han population from non-han population in Chinese. J Forensic Sci Med 2020;6:1-4 |
How to cite this URL: Nan H, Lu D. A potential marker DYF371 for differentiating han population from non-han population in Chinese. J Forensic Sci Med [serial online] 2020 [cited 2021 Jan 22];6:1-4. Available from: https://www.jfsmonline.com/text.asp?2020/6/1/1/280892 |
Introduction | |  |
Y chromosome is different from autosome since the characteristic of Y chromosome is non-recombination in most parts of it.[1] Therefore, the genetic diversity of the Y chromosome is relatively low.
The Y chromosome short tandem repeats (STRs) located on Y chromosome palindromes have more genetic diversity than those on non-palindromes.[2],[3] DYF371 is a four-copy locus located on Y chromosome palindrome P1 and P5 [Supplement Figure 1]. Single-nucleotide polymorphism (SNP) sites rs1250403754 and rs1556285687 are found in the flanking regions of DYF371. Therefore, the alleles of DYF371 locus have two SNP types which are T-type or C-type [Supplement Figure 1]. Recently, several papers have reported gene diversity for DYF371 locus in different population groups.[4],[5],[6],[7] Their data demonstrated DYF371 locus had the potential for identifying male individuals and analyzing genetic genealogy in forensic field. However, few of the allele frequencies for DYF371 have been investigated in Chinese population. In addition, the SNP-types had not been detected previously. The distribution of haplotypes of SNP-STRs is still unclear. Therefore, in this study, we will explore the length polymorphism of DYF371 and its flanking SNP types in the Chinese Han population and minority groups.
Materials and Methods | |  |
DNA samples
Bloodstain samples were collected from 142 Chinese males. The samples included 90 individuals from Han population and 52 unrelated males from nine minority groups: Kazakh (5), Mongolian (4), Hui (4), Yi (5), Shui (5), Tujia (5), Zhuang (5), and Tibetan (20). The study was approved by the Human Subjects Committee at Zhongshan School of Medicine, Sun Yat-Sen University. Informed consent was obtained from the participants. Ethical clearance was obtained from the Ethics Committee of Sun Yat-Sen University.
Multiplex polymerase chain reaction amplification
The SNP-STR genotypes DYF371T-type and DYF371C-type were analysed using the primers described in the previous study.[8] The forward primer sequence was 5'- AGTAATTCTGGAGGTAAAATGG3'. The backward primer sequence for DYF371C-type was: ROX -5'-TGGAGAGAAGAAGAGAGAAAC-3', and for DYF371T -type was: FAM-5'-TGGAGAGAAGAAGAGAGAAAT-3' [Figure 1]. The multiplex PCR amplification was carried out using a 1.2 mm punched bloodstain on filter paper, without DNA extraction. PCR strategy was performed in a total volume of 10 μl containing of 2 μl Golden 2 × PCR Master Mix (Peoplespot Inc., Beijing, China), 2 μl PCR primers mix, and 6 μl H2O. Cycling conditions were as follows: initial denaturation at 95°C for 11 min; then 30 cycles of 30 s at 94°C, 75 s at 62°C, 60 s at 72°C; and final extension of 45 min at 61°C. PCR was carried out in a GeneAmp® 9700 PCR System (Applied Biosystems, Foster City, USA). | Figure 1: The alleles of DYF371 locus could be distinguished by single-nucleotide polymorphism-shor t tandem repeat primers (C-type and T-type). The first row showing the forward primer for short tandem repeat type. The second row showing the sequence of DYF371C from Genebank. The third row showing the primer of single-nucleotide polymorphism C-type. The last row showing the primer of single-nucleotide polymorphism T-type. The box showing the single-nucleotide polymorphism sites
Click here to view |
Single-nucleotide polymorphism-short tandem repeat of DYF371 typing
PCR products were prepared for capillary electrophoresis (CE) by combining 1 μl of amplified product with 9 μl of a 30:1 mixture of deionized Hi-Di formamide (Applied Biosystems, Foster City, USA) and Internal Lane Standard ORG (Peoplespot Inc., Beijing, China). PCR products were separated and detected on an ABI PRISM® 3500xL Genetic Analyzer (Applied Biosystems, Foster City, USA) and analyzed by GeneMapper ID v. 1.4 software (Applied Biosystems, Foster City, USA) according t o the manufacturer's instructions. Control DNA 007 (Applied Biosystems, Foster City, USA) or 9948 (Applied Biosystems, Foster City, USA) were genotyped as a standard reference.
Cloning sequencing analysis of the alleles of DYF371 were performed by the Beijing Genomics Institute (BGI, Shengzhen China).
Data analysis
We counted the genotype frequencies of the DYF371 locus. The gene diversity (GD) was calculated using the formula: where n is the number of haplotypes, pi is the frequency of the ith haplotype. Haplotype discrimination capacity (DC) was determined as DC = h/N, where h is the whole number of different haplotypes and N is the total number of individuals in the samples.[9]
Results and Discussion | |  |
Description of the multiplex polymerase chain reaction system
Normally, DYF371 shows four allele copies on the Y chromosome [Supplementary Figure 1].[10] One copy of the allele on palindromes P1 or P5 has a tightly linked SNP site rs1250403754 or rs1556285687, respectively [Supplementary [Figure 1]. The SNPs involving T and C-type were defined as DYF371C or DYF371T here. The multiplex PCR assay described here was constructed to simultaneously amplify the STR of DYF371 and SNP sites DYF371C and DYF371T. The number of STR repeats of DYF371 and SNP in the flanking regions of the STR locus could be detected by PCR products produced from above SNP-STR primers [Figure 1]. A representative electropherograms of control DNA 9948 and 007 for our multiplex PCR are shown in [Figure 2].
 | Figure 2: The typical electropherograms of 007 and 9948 control DNA for duplex polymerase chain reaction of DYF371T and DYF371C
Click here to view |
Genetic diversity of DYF371C and DYF371T
The result from sequencing analysis showed that the repeat structure of DYF371 is (GTT)n. The sequence of allele 10C of control DNA 9948 is presented in [Supplementary Figure 2]. The allele lengths varying from 9 to 17 repeats were found at DYF371 locus in this study. Four different alleles with T-type SNP ranging from 10T to 13T repeats and nine alleles with C-type SNP ranging from 9C to 17C repeats were observed. When repeat number of STR was combined with the SNP types, the number of alleles at DYF371 locus has reached up to 13, which increased 4 alleles than those only counted for sizes of alleles. Hence, the addition of SNP information can result in an extension in the number of allele types and improve the discriminating power of DYF371 locus.
Depending on the result of electropherograms, 37 different genotypes were found in the 142 Chinese male individuals. [Table 1] shows the number and frequency of different haplotypes at DYF371 locus including alleles of repeat number and SNP-type (C-type and T-type). Among them, 11T, 13C, 15C haplotype showed 48 times (20.69%) which is the most frequent haplotype. Nine of these 37 genotypes were unique (24.32%). The GD value and DC value are 0.8321 and 0.2606, respectively. The results demonstrate that the high polymorphism of DYF371 locus is suitable for differentiating male individuals.
Redd et al. had reported the gene diverisity (GD) of DYF371 was 0.929 in the Asians, slightly more than the GD value of 0.814 in the Europeans/Middle Easterners[5] and our value of 0.8321. The GD values were only 0.623 in the Africans[5] and 0.589 in European–Americans from South Dakota, respectively, which were significantly lower than our result. Wang et al. discovered 23 alleles ranged from 10 to 15 repeats for DYF371 in Guizhou Gelao ethnic group from Western China, and the GD value was 0.8983.[6] However, the alleles of DYF371 were not differentiated by SNP-type in their assay. Therefore, their result disagreed with our finding. On the whole, the genetic variant of DYF371 locus is different in various population. This indicates that the DYF371 is a suitable marker for paternal bio-geographic ancestry inference worldwide. Unfortunately, the genetic distances can not be estimated since the haplotype frequencies are unavailable.
The different genotype of DYF371 locus between Chinese Han population and minorities
It is well known that SNPs are ancestry informative markers.[11] Across the 90 Han Chinese examined, only three individuals (3.333%) showed the allele 10C and 14 individuals (12.22%) showed allele 11C. On the contrary, 19 out of 52 individuals (36.53%) had allele 10C and only two individuals (3.84%) had allele 11C in the samples of ethnic minorities. Therefore, the alleles 10C or 11C will be helpful to differentiate the Han and non-Han Chinese populations.
Furthermore, the copy numbers of an allele with SNP C-type are significantly different between the samples from Han and non-Han Chinese populations. Based on the electrophoretograms, only five males (5.55%) were determined unambiguously that they had three copies of alleles with SNP C-types in the Han samples. On the contrary, similar genotypes were observed clearly in 14 individuals (26.92%) from the samples of minorities [Table 2]. The genotype proportion comprised of three distinguishing copies of the allele with SNP C-types in Han sample was greatly lower than that in the sample of minorities [Table 2]. Therefore, the genotype pattern that consists of three distinct copies of the allele with SNP C-types will be very informative for Chinese bio-geographical ancestry analysis. | Table 2: The distribution of three alleles with DYF371C-type in Chinese Han population and minorities
Click here to view |
Conclusion | |  |
A multiplex PCR has been developed to analyze the SNP-STR of DYF371 locus. This PCR detected simultaneously the size of DYF371 and the SNPs in the flanking region. A total of 37 SNP-STR haplotypes were found in a sample of 142 individuals from Chinese. The haplotype diversity and discrimination capacity were 0.8321 and 0.2606, respectively. The result indicated that the SNP-STR-type 10C and genotypes had 11T and three copies of the C-type alleles with different repeat numbers and SNP C-type were more common in non-Han population than those in Han population in Chinese. Therefore, the SNP-STR of DYF371 is a very valuable marker with population-differentiated informative for inferring of Chinese bio-geographical ancestry.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
References | |  |
1. | Trombetta B, Cruciani F. Y chromosome palindromes and gene conversion. Hum Genet 2017;136:605-19. |
2. | Tanaka H, Yao MC. Palindromic gene amplification-An evolutionarily conserved role for DNA inverted repeats in the genome. Nat Rev Cancer 2009;9:216-24. Epub 2009 Feb 12. |
3. | Trombetta B, Atanasio ED, Cruciani F. Patterns of inter-chromosomal gene conversion on the male-specific region of the human Y chromosome. Front Genet 2017;8:54. |
4. | Kayser M, Kittler R, Erler A, Hedman M, Lee AC, Mohyuddin A, et al. A comprehensive survey of human Y-chromosomal microsatellites. Am J Hum Genet 2004;74:1183-97. |
5. | Redd AJ, Agellon AB, Kearney VA, Contreras VA, Karafet T, Park H, et al. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci Int 2002;130:97-111. |
6. | Wang X, Jiang L, Qian E, Long F, Cui W, Ji A, et al. Genetic polymorphisms and haplotypic structure analysis of the Guizhou Gelao ethnic group based on 35 Y-STR loci. Legal Med 2020;43:101666. |
7. | Hanson EK, Ballantyne J. An ultra-high discrimination Y chromosome short tandem repeat multiplex DNA typing system. PLoS One 2007;2:e688. |
8. | Jobling MA, Samara V, Pandya A, Fretwell N, Bernasconi B, Mitchell RJ, et al. Recurrent duplication and deletion polymorphisms on the long arm of the Y chromosome in normal males. Human molecular genetics 1996;5:1767-75. |
9. | Hanson EK, Ballantyne J. A highly discriminating 21 locus Y-STR “megaplex” system designed to augment the minimal haplotype loci for forensic casework. J Forensic Sci 2004;49:40-51. |
10. | Hanson EK, Ballantyne J. Comprehensive annotated STR physical map of the human Y chromosome: Forensic implications. Leg Med (Tokyo) 2006;8:110-20. Epub 2005 Dec 7. |
11. | Kayser M. Forensic use of Y-chromosome DNA: A general overview. Human Genetics 2017;136:621-35. |
[Figure 1], [Figure 2]
[Table 1], [Table 2]
|